File:Nussinov78 AF083069.1 1-43.svg

Original file(SVG file, nominally 512 × 512 pixels, file size: 24 KB)

This file is from Wikimedia Commons and may be used by other projects. The description on its file description page there is shown below.

Summary

Description Secondary structure of a maximal basepairing of a RNA subsequence of the Echovirus 5 genome (EMBL Accession number AF083069.1_1-43). This structure is predicted with the Nussinov 78 algorithm und is one of 42 optimal structures. The input sequence is "UUAAAACAGCCUGUGGGUUGCACCCACCCACAGGGCCCACUGG" and the dot-bracket string of the shown secondary structure is "(())..(.()(((((((((())...)))))))((()))(.)))". The image was created and exported with RNAMovies 2.04 as svg. To correct the margin it was edited with Inkscape.
Source Own work
Author Bgw

Licensing

I, the copyright holder of this work, hereby publish it under the following licenses:
w:en:Creative Commons
attribution share alike
This file is licensed under the Creative Commons Attribution-Share Alike 3.0 Unported license.
You are free:
  • to share – to copy, distribute and transmit the work
  • to remix – to adapt the work
Under the following conditions:
  • attribution – You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in any way that suggests the licensor endorses you or your use.
  • share alike – If you remix, transform, or build upon the material, you must distribute your contributions under the same or compatible license as the original.
GNU head Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any later version published by the Free Software Foundation; with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts. A copy of the license is included in the section entitled GNU Free Documentation License.
You may select the license of your choice.

Captions

Add a one-line explanation of what this file represents

Items portrayed in this file

depicts

File history

Click on a date/time to view the file as it appeared at that time.

Date/TimeThumbnailDimensionsUserComment
current19:36, 13 June 2008Thumbnail for version as of 19:36, 13 June 2008512 × 512 (24 KB)Bgw{{Information |Description= |Source= |Date= |Author= |Permission= |other_versions= }}
19:29, 13 June 2008Thumbnail for version as of 19:29, 13 June 2008744 × 1,052 (24 KB)Bgw{{Information |Description=Secondary structure of a maximal basepairing of a RNA subsequence of the Echovirus 5 genome (EMBL Accession number AF083069.1_1-43). This structure is predicted with the Nussinov 78 algorithm und is one of 42 optimal structures.

The following page uses this file:

Global file usage

The following other wikis use this file: